R1b1c2 aka M65

John McEwan

23 October 2006

Background

M65 is a SNP that defines subclade R1b1c2 in the ISOGG 2006 Y chromosome tree.

Technical details

The SNP was described by Underhill et al (2001) as

M65 A->T 152 ttctgatgccagcttgttcg gctacgggattaaagtaaccttg

Using May 2006 Golden Path and in silico PCR the following sequence was obtained from Yq11.222 within the SMCY gene. The M65 mutation itself was manually annotated (yellow below). The A allele is ancestral. This SNP does not seem to be currently listed in dbSNP.

>chrY:20365502+20365937 436bp TTCTGATGCCAGCTTGTTCG GCTACGGGATTAAAGTAACCTTG
TTCTGATGCCAGCTTGTTCGggtcagaaaagttaaatgagaaatttggtg
ctaagggtttctggtcatgagtgtaaataacgcctcgccaagtggtaaac
tgccccaacgttcaaaccaaaggctacccattcccaaattttgtttcaaa
g[a/t]cttaccgcgggtgggcggattttgcagatgccagacttctctgctatg
ggccttattttcgcaatgtagccaagcgggtcttggaattcagcccagct
aggctcaaaaaccgggcactccggtggcggcaggaactcgtcacaccccg
gttccatgtcgggccttaatgctaagctgtaaaataagaatcacattgtc
tttaatgacgcgctggttcctcctactaaaaggcctatgaaaatttcatt
ttcttgagaatttCAAGGTTACTTTAATCCCGTAGC

Occurrence

It was first described by Underhill et al (2000) where it was reported in 2 “Basque” after genotyping 1062 individuals from a variety of countries. The Basques were presumably unrelated. The SNP was originally detected scanning a global population of 53 individuals. To date even though it has been tested in several studies and many thousands of people no further derived individuals have been found. A critical study of Basques (Alonso et al., 2005) genotyped this SNP on 168 unrelated Basques, and 691 non Basque Iberians and did not detect a single example.

Summary

This SNP appears to be a private SNP that is at very low frequency within the Basque population.

References

Alonso S, Flores C, Cabrera V, Alonso A, Martin P, Albarran C, Izagirre N, de la Rua C, Garcia O. 2005. The place of the Basques in the European Y-chromosome diversity landscape. Eur J Hum Genet. 2005 13:1293-302.

Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ. 2000. Y chromosome sequence variation and the history of human populations. Nat. Genet. 26:358-361

Underhill, P.A., Passarino, G., Lin, A.A., Shen, P., Mirazon Lahr, M., Foley, R.A., Oefner, P.J. and Cavalli-Sforza, L.L. 2001. The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations. Ann. Hum. Genet. 65: 43-62.